dermatolog milicz nfz ad

W wieku 20 lat zapisał się do fazy 1-2 badania G-CSF (Filgrastim) w Hanowerze w Niemczech. W tym czasie badania szpiku kostnego ujawniły zatrzymanie mielopoezy w stadium promielocytowym lub mielocytarnym przy braku pasm i segmentowych neutrofili. Nie było żadnych objawów mielodysplazji, a komórkowość szpiku kostnego była prawidłowa. Leczenie G-CSF (3 .g na kilogram masy ciała na dobę) zwiększyło liczbę neutrofilów do poziomu powyżej 2000 na milimetr sześcienny w ciągu dwóch tygodni. W ciągu następnych dwóch lat liczba granulocytów obojętnochłonnych utrzymywała się na tym poziomie z tą samą dawką G-CSF, a pacjent nie miał poważnych infekcji. Dwa lata po rozpoczęciu leczenia G-CSF, rutynowe badanie szpiku kostnego wykazało monosomię 7 w linii mieloidalnej, ale nie było oznak dysplazji lub białaczki. Leczenie G-CSF zostało natychmiast przerwane, ale zostało ono ponownie uruchomione dwa miesiące później, na prośbę pacjenta, z powodu ciężkiego zapalenia jamy ustnej. Jedenaście miesięcy później rozwinął się zespół mielodysplastyczny (podtyp charakteryzujący się niedokrwistością oporną i nadmiar blastów) i trombocytopenia. Po dodatkowych ośmiu miesiącach pacjent otrzymał ostrą białaczkę szpikową (podtyp M1 według klasyfikacji francusko-amerykańsko-brytyjskiej), a następnie zmarł.
Metody
Amplifikacja reakcji łańcuchowej polimerazy
Genomowy DNA wyizolowano z różnych źródeł komórkowych, jak to opisano gdzie indziej.22 Całkowity RNA wyizolowano z komórek białaczkowych od Pacjenta 2 metodą Chomczyńskiego i Sacchi.23 RNA poddano odwrotnej transkrypcji do komplementarnego DNA (cDNA) z użyciem odwrotnego DNA. transkryptaza wirusa białaczki mysiej Moloney (GIBCO-BRL, Breda, Holandia). Amplifikację z reakcją łańcuchową polimerazy (PCR) przeprowadzono jak opisano uprzednio21. Zastosowano następujące startery: FW2, 5 tgtgatcatcgtgactccctt3 (do przodu); FW3, 5 ctgctgttgttaacctgcctc3 (do przodu); FW4, 5 ccaagagcagtttccacccaggcc3 (forward); FWI16, 5 accctttgtgttccaccaGT3 (do przodu); RV1, 5 caagatctagtttacaatactgaag3 (wsteczny); RV2, 5 gtagatcttagtcatgggcttatgg3 (wsteczny); i RV3, 5 tctcaggggagatagtgccc3 (wsteczny). Podkreślone nukleotydy wskazują wprowadzone niedopasowania.
Sekwencjonowanie nukleotydów
Po elektroforezie na żelu agarozowym, fragmenty PCR oczyszczono za pomocą zestawu Geneclean II (Bio 101, La Jolla, CA) i sekwencjonowano bezpośrednio lub po subklonowaniu w wektorze pBluescript (Stratagene, La Jolla, CA) za pomocą Zestaw do sekwencjonowania T7 (Pharmacia PL Biochemicals, Milwaukee).
Wektory ekspresyjne dla receptora G-CSF
CDNA kodujący skrócony receptor G-CSF (zmutowany DA18) sklonowano w miejscu restrykcyjnym EcoRI pseudowirusowego wektora ekspresyjnego pBabe-puro, który zawierał gen oporności na puromycynę, 24 dając początek konstruktowi pBabe-DA. Aby utworzyć pełnej długości cDNA kodujący skrócone receptory G-CSF u dwóch pacjentów, fragmenty PCR otrzymane od Pacjentów i 2 z zestawami primerów FWI16-RV1 i FW2-RV1, odpowiednio, wstawiono do miejsca restrykcyjnego HincII pBluescriptu. wektor, a następnie pocięto CfrlIO i XhoI. Uzyskane fragmenty Cfrll i Xhol użyto do zastąpienia fragmentu Cfrll-Sall konstruktu pBabe-DA, tworząc w ten sposób wektory ekspresyjne pBabe-1 i pBabe-2 odpowiednio dla Pacjentów i 2
[przypisy: krótkie wędzidełko napletka, usg dopplera cena, dentysta na warszawskiej gdańsk ]

Dodaj komentarz

Twój adres email nie zostanie opublikowany. Pola, których wypełnienie jest wymagane, są oznaczone symbolem *

Powiązane tematy z artykułem: dentysta na warszawskiej gdańsk krótkie wędzidełko napletka usg dopplera cena